Monday, June 3, 2019
Antimicrobial and Antioxidant Activity: Secondary Metabolite
Antimicrobic and Antioxidant Activity Secondary MetaboliteNatural products remains a consistent source of drug charters with much than 40% of new chemical entities (NCEs). It has become imperative to explore microorganisms for NCEs and lead drug molecules for the drug discovery. Keeping this in view bioprospecting of microorganisms is carried out from every practicable source, including extreme environments like ocean beds, geothermal vents, cold desserts etc., in search of novel forms with promising bioactivities. During the past two decades it has been observed that much wealth of microbial biodiversity with novel biochemistry and secondary metabolite production resides in endophytes. So far, numerous bioactive molecules have been isolated from endophytic kingdom Fungi. An important step towards tapping their potentials for human welfare including drug discovery and sustainable agriculture, it is very essential to isolate endophytes from various ecological niches. Among the endophytes lichen associate fungi are unique organisms that have potential bioactive properties including, antibiotic, antioxidant, antiviral, anti-inflammatory, analgesic antipyretic, anti-proliferating and cytotoxic activities. In this assume endolichenic fungi was isolated from crustose lichen Lecanora sp. collected from Horsley Hills, Andhra Pradesh. The isolated endolichenic fungi was identified as Talaromyces tratensis on the basis of ITS4and ITS5 ribosomal gene sequences. The fermented broth is potential source for anti-metabolites. The metabolites unwashed active against gram plus, gram negative bacteria and fungal pathogens. The most distinguished free radical scavenging natural process was observed for Ethyl acetate stub out of fungal mycelium. The EC50 values based on the DPPH (1, 1- Diphenyl-2- Picrylhydrazyl), Hydrogen peroxide and Nitric oxide were 45.500.01, 32.610.06 and 66.540.01 respectively.Keywords Antioxidant military action, Crustose Lichens, Endolicheni c fungi and Talaromyces tratensisThe Name endolichenic fungi was introduced by Miadlikowsk in 2004 1. Endolichenic fungi signifies a vital ecological group of species that form close associations with lichens 2, which lives as endosymbiotic micro fungi in the thallus of lichens and resemble to endophytic fungi live in the intercellular spaces of the position hosts 3-5. To date about 100,000 fungal species are identified even if distant more than one million are expected. The diversity of species and the variety of their habitations, some of them unexplored, this lead to be fungi as a rich source of novel metabolites 6. Besides that Endolichenic fungi are untapped and new treasured source for bioactive metabolite products 5, 7 whole a few investigations have been reported on the bioactive metabolites of endolichenic fungi, but they have shown great potential to be a new source for structurally versatile and biologically active natural products 5, 8-10. Secondary metabolic products of endolichenic fungi shows distinct bioactivities like antimicrobial 5, 9, 11, antiviral 12, antioxidant 13-14 anticancer and cytotoxic 7, 9-10, 13-16. These bioactive compounds have great hump in development of pharmaceutical drugs, nutraceuticals and agrochemicals. The present study was carried out to investigate antimicrobial and antioxidant activities of endolichenic fungi Talaromyces tratensis inhabiting the lichen Lecanora spp. Collected from Horsley hills, Andhra Pradesh, India. This research was aimed determining the antimicrobial and antioxidant activity of secondary metabolites present in the ethyl group acetate (EtOAc) extract of Talaromyces tratensis fermented in potato dextrose Broth (PDB) and their potential for the production of bioactive compounds.MATERIALS AND METHODS Sample Collection The lichens were collected from Horsley hills (13.66N 78.40E), 147 km of a part of Sheshachalam Hills range, Andhra Pradesh. The lichens were located at an altitude of 1,290m abov e sea level. The lichen types were collected from different substrates and transported into the laboratory in sterilized paper bags. isolation of Endolichenic Fungi The fungi Talaromyces tratensis isolation was carried out by modified method of Guo et al.,2003 and Kannagara et al.,2009 17-18. Healthy lichen thalli were cleaned in running tap water to the remove dust particles, swarm and then washed with milli-Q watter. The surface sterilized by consecutive immersion for 4min in 2% Sodium Hypochlorite, with Hydrogen peroxide for 2min followed by immersed in 30 s in 75 % ethanol. The thalli surface were dried with sterile filter papers and aseptically cut into small segments (0.5 - 1 cm) and were evenly placed in to each one(prenominal) 90mm Petri dishes containing Potato Dextrose agar ( labor organizer) with Streptomycin Sulphate (50g/ 100ml). The PDA plates were sealed with Paraffin film and incubated at 28C for 7days. Fungi grown from each lichen segment and make into pure cult ures. Slides containing pure cultures were prepared exploitation the slide culture method 19 and identified using identification keys 20. The ripening fungi Talaromyces tratensis were sub-cultured on PDA.Molecular identification of the isolated endolichenic fungus Genomic DNA isolated in the pure form from the fresh biomass of Endolichen fungus by CTAB (N-cetyl N,N, Ntrimethyl -ammonium bromide) method 21, the Identification of isolated pure strain of the endolichenic fungus was carried out using a molecular biological protocol by genomic DNA extraction, internal spacer transcribed (ITS) region amplification and sequencing.The ITS region of rDNA was successfully amplified by PCR was set up with ABI Big sully Terminatorv3.1 cycle sequencing kit and using fungal universal primers ITS4 (5 TCCTCCGCTTATTGATATGC 3) ITS5 (5 GGAAGTAAAAGTCGTAACAAGG 3) 22. It was sequenced in both directions using the respective PCR primers. For this purpose, the Big Dye terminator sequencing kit (Version 3.1, Applied Biosystems) and an ABI 3100 automated DNA sequencer (Applied Biosystems) were used. Raw Gene sequence was manually edited for inconsistency and the predicted sequence data were adjust with public available sequences and analyzed to reach identity by using NCBI BLAST (http//www.ncbi.nlm.nih.gov/blast/).Fermentation and extraction The fermentation was carried out in Erlenmeyer flasks using a complex medium consisting of Potato Dextrose Broth (HIMEDIA Laboratories). The flasks containing 200 mL fermentation medium were inoculated with 5 days old actively growing T. tratensis mycelial agar discs (6mm), the Flask cultures allowed for inoculum development and fermentation at 282C, pH 7.0 with orbital shaking at 120 rpm 23. after(prenominal) 14days of Fermentation the fungal biomass was separated with Whatman No.1 filter paper from fermented broth and filtered broth was allowed to liquid-liquid separation with EtOAc (11 ratio) in a separatory funnel. After this procedure, th e organic solvent was evaporated below reduced pressure to dryness to yield an EtOAc extract 24.Antibacterial Activity To evaluate Antibacterial activity of T. tratensis EtOAc crude extract sampleed against gram positive (Bacillus cereus and Staphylococcus aureus) and gram negative bacterial pathogenic strains (Escherecia coli, Pseudomonas fluorescence, Klebsiella pneumonia and Salmonella typhi) by agar well diffusion method 25-26. Antibacterial activity was evince as the percent inhibition (%) of bacterial proceeds using the following formula C-T/C X 100.Antifungal activity The antibacterial activity in in vitro was dilution determined against the pathogenic fungi Fusarium oxysporium, Colletotrichum capsisi and Aspergillus niger by poison food technique 27. 1 ml of tenfold of the EtOAc extracts were mixed with molten PDA separately and then poured into Petri dishes and control PDA plates supplemented with sterile distilled water. A mycelia disc of tested pathogens was transferr ed on the center of both test and control plates and incubated for 5days at 28C. The mycelial radial was measured and the percentage of inhibition was expressed by using following formula T1 T2/ T1 X 100.Screening for Antioxidant activity DPPH Assay Free Radical-scavenging activity of T. tratensis extract against stable 2, 2 diphenyl 2 picrylhydrazyl hydrate (DPPH) was determined by the s at large(p)ly modified method of Prior R.L. et al., 2005 28. DPPH reacts with an antioxidant compound which can donate atomic number 1 and reduce DPPH. The change in colour (from deep violet to light yellow) was measured at 517 nm on a UV visible light spectrophotometer. The solution of DPPH in methanol 0.2mM was prepared fresh daily before UV measurements. One milliliter of this solution was individually mixed with ethyl acetate extracted crude sample of T. tratensis (25mg, 50mg, 100mg and 200mg). The samples were kept in the dark for 15 minutes at room temperature and the decrease in absorbance was measured. The experiment was carried out in triplicate. Radical-scavenging activity was calculated by the following formulaInhibition Percentage % = ( untenanted sample)/ sportsmanlike - 100Whereblank is the absorbance of the control reaction and sample is the absorbance in the presence of purified molecules end of Antioxidant Activity by Reducing Power Measurement The reducing power of the extract was determined according to Oyaizu 1986 29 with slight modifications. An amount of 25mg, 50mg, 100mg and 200mg of extracted sample was added to 2mL of 1% chiliad ferricyanide. After incubating the mixture at 50C for 30 min, during which ferricyanide was reduced to ferrocyanide, it was supplemented with 2mL of 1% trichloroacetic acid and 2% FeCl3 and left for 20 min. Absorbance was read at 700 nm to determine the amount of ferric ferrocyanide (Prussian blue) formed. Higher absorbance of the reaction mixture indicates higher reducing power of the sample. ISSN 0975-8585September Octob er 2016 RJPBCS 7(5) Page No. 1415 Inhibition Percentage % = (blank sample)/blank - 100Determination of Nitric Oxide (NO) Scavenging Activity Nitric oxide production from sodium nitroprusside was measured according to Jagetia 2004 30. An equal amount (6 mL) of sodium nitroprusside (5mM) solution was mixed with extracted sample (25mg, 50mg, 100mg and 200mg) and incubated at 25C for 180 min. After every 30 min, 0.5 mL of the reaction mixture was mixed with an equal amount of Griess reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% napthylethylene diamine dihydrochloride), and absorbance was taken at 546 nm and compared with absorbance of 1 mg/mL of standard solution (sodium nitrite) treated in the same way with Griess reagent.Inhibition Percentage % = (blank sample)/blank - 100.RESULTS AND DISCUSSION Endolichenic fungi are residing in living thalli of lichens and that similar to endophytic fungi asymptomatically in internal tissues of all higher plants 3-5. In Recently the bio logy of Endolichenic fungi are renowned to interesting novel sources of biologically active compounds. This study focuses on the biology of endolichenic fungi, their discovery, isolation, identification, and their biological activities in invitro.In our present research, we isolated noble-minded and interesting Endolichenic fungus from crustose type lichen Lecanora spp. (Fig.1) collected from Horsley Hills, Andhra Pradesh. The morphological characters of the isolate were slow-growing, yellow in colour, conidiophores having smooth, lateral branching, conidia aseptate, phialides and ascospores (Fig.3). The ITS sequence of endolichenic fungus 100% similarity with Talaromyces tratensis sequences from Gene-Bank and this endolichenic fungus was identified as Talaromyces tratensis (Fig.3). antecedently several endolichenic fungi and their bioactive metabolites 7, 11-13 reported nevertheless Talaromyces tratensis newly reporting to produce and interesting bioactive metabolites with antimic robial, and antioxidant properties. To our knowledge, this is the first report of this organism as an endolichenic fungi from Lichens.Crude metabolites of the T. tratensis were extracted with ethyl acetate as organic solvent by using solvent extraction procedure. The crude extract was evaluated for antibacterial and antifungal activity against some clinically significant microorganisms following agar well diffusion assay and poison food technique respectively. The metabolites displayed moderate to strong antibacterial activity (Fig. 4) against all the test pathogens. The metabolites showed highest in vitro activity against Klebsiella pneumoniae followed by Escherichiacoli, Salmonella typhi, Proteus vulgaris, Bacillus substiles, Pseudomonas fluorescence and Staphylococcus aureus (Table. 1). In food poison technique for antifungal activity (Fig. 5), it shows 82.59% Ihighest growth inhibition on Colletotrichum capsisi, followed by Aspergillus niger and Fusarium oxysporium (Table. 2).Ta ble. 1 Antibacterial activity of T. tratensis Name of Bacteria % of growth inhibition at different concentration 25l 50l 75l 100l Klebsiella pneumoniae 33.5657.7566.6375.94Escherichia coli 30.9356.7966.7575.66Salmonella typhi 30.9856.3266.5274.39Proteus vulgaris 31.7055.2866.0069.83Bacillus substiles 31.6748.0664.8672.61Pseudomonas fluorescence 29.3849.4764.9572.61Staphylococcus aureus 31.6748.0664.8670.94
Subscribe to:
Post Comments (Atom)
Implementation and Challenges of Lean Concept in Human resources Essay Example for Free
Usage and Challenges of Lean Concept in Human assets Essay Going lean is the discussion of the period. Practically all the large associat...
-
' maximize Your great powers And electromotive force( carry survival From: Succes academy succeederercising - made surviving c...
-
'What you gestate c on the wholeion to bum constitute a wide rest in your liveliness. It sens shanghai how you feel, what yo...
-
'I debate that costly last conveys pop of either mediocre seat. in that location is a cause for entirely(prenominal)thing ...
No comments:
Post a Comment
Note: Only a member of this blog may post a comment.